Detail of EST/Unigene EV259481 |
Acc. | EV259481 |
Internal Acc. | MTYDW52TF |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Ribulose-1,5 bisphosphate carboxylase/oxygenase large subunit N-methyltransferase, chloroplastic OS=Pisum sativum E-value=3e-07; Aldolases N-methyltransferase, chloroplastic OS=Arabidopsis thaliana E-value=2e-06; Ribulose-1,5 bisphosphate carboxylase/oxygenase large subunit N-methyltransferase, chloroplastic OS=Nicotiana tabacum E-value=5e-06; |
Length | 821 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_JCVI-MT1; |
Sequence | AATGTCATTTCGCGTTGCAACCCTCCGTCGCTGGTCTCTGCATACTGTTGTTTTCAATTT |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 824674 |
Trichome-related Gene from Literature | N/A |