| Detail of EST/Unigene EV259596 |
| Acc. | EV259596 |
| Internal Acc. | MTYDX80TF |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | 3-oxoacyl-[acyl-carrier-protein] reductase FabG OS=Thermotoga maritima (strain ATCC 43589 / MSB8 / DSM 3109 / JCM 10099) E-value=1e-30; 3-oxoacyl-[acyl-carrier-protein] reductase FabG OS=Bacillus subtilis (strain 168) E-value=5e-27; 3-oxoacyl-[acyl-carrier-protein] reductase FabG OS=Staphylococcus epidermidis (strain ATCC 12228) E-value=7e-27; 3-oxoacyl-[acyl-carrier-protein] reductase FabG OS=Staphylococcus epidermidis (strain ATCC 35984 / RP62A) E-value=7e-27; 3-oxoacyl-[acyl-carrier-protein] reductase, chloroplastic OS=Cuphea lanceolata E-value=1e-26; |
| Length | 829 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_JCVI-MT1; |
| Sequence | GATTTTCTCATTTCAATAAATCATCATAAAACCCCCATTTTCAACATTCTTTCATTTCTT |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Metabolism > Lipid Metabolism > ko00150 Androgen and estrogen metabolism > K00044 estradiol 17beta-dehydrogenase; ; Metabolism > Metabolism of Cofactors and Vitamins > ko00830 Retinol metabolism > K11147 dehydrogenase/reductase SDR family member 4 |
| EC | 1.1.-.- |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 824695 |
| Trichome-related Gene from Literature | N/A |