Detail of EST/Unigene EV259656 |
Acc. | EV259656 |
Internal Acc. | MTYDY51TF |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | 33 kDa ribonucleoprotein, chloroplastic OS=Nicotiana sylvestris E-value=7e-41; 29 kDa ribonucleoprotein A, chloroplastic OS=Nicotiana sylvestris E-value=1e-18; 29 kDa ribonucleoprotein B, chloroplastic OS=Nicotiana sylvestris E-value=2e-18; 30S ribosomal protein 2, chloroplastic OS=Spinacia oleracea E-value=5e-18; 30 kDa ribonucleoprotein, chloroplastic OS=Nicotiana plumbaginifolia E-value=6e-18; |
Length | 752 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_JCVI-MT1; |
Sequence | GATGCATTTGAATATAGCATAATAACCAACCATGGCTGGTGCAAGCACTGGTTCCTTCCC |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 824403 |
Trichome-related Gene from Literature | N/A |