Detail of EST/Unigene EV259668 |
Acc. | EV259668 |
Internal Acc. | MTYDY63TF |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Choline monooxygenase, chloroplastic OS=Arabidopsis thaliana E-value=4e-72; Choline monooxygenase, chloroplastic OS=Atriplex hortensis E-value=7e-62; Choline monooxygenase, chloroplastic OS=Spinacia oleracea E-value=6e-58; Choline monooxygenase, chloroplastic OS=Amaranthus tricolor E-value=4e-57; Choline monooxygenase, chloroplastic OS=Beta vulgaris E-value=6e-56; |
Length | 874 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_JCVI-MT1; |
Sequence | GGATGTGCATAGTAATTTCTCTTCTCTAAGATAAATACAATGCAAAAGAAAAGTTAAAAA |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 829111 |
Trichome-related Gene from Literature | N/A |