| Detail of EST/Unigene EV259713 |
| Acc. | EV259713 |
| Internal Acc. | MTYDZ18TF |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Proliferating cell nuclear antigen OS=Pisum sativum E-value=1e-62; Proliferating cell nuclear antigen (Fragment) OS=Glycine max E-value=5e-62; Proliferating cell nuclear antigen OS=Nicotiana tabacum E-value=4e-61; Proliferating cell nuclear antigen OS=Daucus carota E-value=2e-60; Proliferating cell nuclear antigen OS=Catharanthus roseus E-value=7e-60; |
| Length | 671 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_JCVI-MT1; |
| Sequence | GTTAGGATGCCATCTGCTGAGTTTGCTAGGATTTGCAAAGATCTTAGTAGCATTGGTGAC |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Genetic Information Processing > Replication and Repair > ko03410 Base excision repair > K04802 proliferating cell nuclear antigen; Genetic Information Processing > Replication and Repair > ko03030 DNA replication > K04802 proliferating cell nuclear antigen; Genetic Information Processing > Replication and Repair > ko03430 Mismatch repair > K04802 proliferating cell nuclear antigen; Genetic Information Processing > Replication and Repair > ko03420 Nucleotide excision repair > K04802 proliferating cell nuclear antigen |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 817506 |
| Trichome-related Gene from Literature | N/A |