Detail of EST/Unigene EV259804 |
Acc. | EV259804 |
Internal Acc. | MTYE034TF |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Putative methylesterase 11, chloroplastic OS=Arabidopsis thaliana E-value=2e-65; Putative methylesterase 15, chloroplastic OS=Arabidopsis thaliana E-value=3e-50; Putative methylesterase 13, chloroplastic OS=Arabidopsis thaliana E-value=6e-50; Putative methylesterase 12, chloroplastic OS=Arabidopsis thaliana E-value=9e-38; Putative methylesterase 14, chloroplastic OS=Arabidopsis thaliana E-value=3e-37; |
Length | 845 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_JCVI-MT1; |
Sequence | GATATACACACCCCCTTCCTCTGCATGCACCCCCACCAACAACAATGGGTAATCTCTGTT |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 822677 |
Trichome-related Gene from Literature | N/A |