| Detail of EST/Unigene EV259804 |
| Acc. | EV259804 |
| Internal Acc. | MTYE034TF |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Putative methylesterase 11, chloroplastic OS=Arabidopsis thaliana E-value=2e-65; Putative methylesterase 15, chloroplastic OS=Arabidopsis thaliana E-value=3e-50; Putative methylesterase 13, chloroplastic OS=Arabidopsis thaliana E-value=6e-50; Putative methylesterase 12, chloroplastic OS=Arabidopsis thaliana E-value=9e-38; Putative methylesterase 14, chloroplastic OS=Arabidopsis thaliana E-value=3e-37; |
| Length | 845 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_JCVI-MT1; |
| Sequence | GATATACACACCCCCTTCCTCTGCATGCACCCCCACCAACAACAATGGGTAATCTCTGTT |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 822677 |
| Trichome-related Gene from Literature | N/A |