Detail of EST/Unigene EV259860 |
Acc. | EV259860 |
Internal Acc. | MTYE103TF |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Glutamyl-tRNA reductase 1, chloroplastic OS=Cucumis sativus E-value=2e-78; Glutamyl-tRNA reductase 1, chloroplastic OS=Arabidopsis thaliana E-value=7e-76; Glutamyl-tRNA reductase 2, chloroplastic OS=Arabidopsis thaliana E-value=1e-74; Glutamyl-tRNA reductase 2, chloroplastic OS=Cucumis sativus E-value=2e-63; Glutamyl-tRNA reductase 1, chloroplastic OS=Hordeum vulgare E-value=8e-58; |
Length | 842 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_JCVI-MT1; |
Sequence | TGTTTCAACTAGTTTCTATGGTGCTAAATTGGAACCTTTGTTCCTTAAATGTTGTTCTTC |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 842198 |
Trichome-related Gene from Literature | N/A |