| Detail of EST/Unigene EV259880 |
| Acc. | EV259880 |
| Internal Acc. | MTYE125TF |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Endo-1,3;1,4-beta-D-glucanase OS=Zea mays E-value=7e-36; Protein AIM2 OS=Saccharomyces cerevisiae (strain ATCC 204508 / S288c) E-value=3e-20; Carboxymethylenebutenolidase homolog OS=Xenopus tropicalis E-value=2e-19; Carboxymethylenebutenolidase homolog OS=Mus musculus E-value=2e-18; Carboxymethylenebutenolidase homolog OS=Xenopus laevis E-value=6e-18; |
| Length | 859 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_JCVI-MT1; |
| Sequence | GATGAAAGATTCCATTGTTTATTCTGTTTGCAAAGAGTTGAAAGGCTTTAGAAATTAGAA |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Metabolism > Xenobiotics Biodegradation and Metabolism > ko00627 1,4-Dichlorobenzene degradation > K01061 carboxymethylenebutenolidase; Metabolism > Xenobiotics Biodegradation and Metabolism > ko00364 Fluorobenzoate degradation > K01061 carboxymethylenebutenolidase; Metabolism > Xenobiotics Biodegradation and Metabolism > ko00361 gamma-Hexachlorocyclohexane degradation > K01061 carboxymethylenebutenolidase |
| EC | 3.1.1.45 |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 821939 |
| Trichome-related Gene from Literature | N/A |