Detail of EST/Unigene EV260014 |
Acc. | EV260014 |
Internal Acc. | MTYE280TF |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Glucan endo-1,3-beta-glucosidase 14 OS=Arabidopsis thaliana E-value=2e-22; Glucan endo-1,3-beta-glucosidase 11 OS=Arabidopsis thaliana E-value=6e-20; Glucan endo-1,3-beta-glucosidase 10 OS=Arabidopsis thaliana E-value=6e-13; Glucan endo-1,3-beta-glucosidase 13 OS=Arabidopsis thaliana E-value=2e-10; Glucan endo-1,3-beta-glucosidase, acidic isoform GI9 OS=Nicotiana tabacum E-value=5e-10; |
Length | 404 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_JCVI-MT1; |
Sequence | AATGTTCTAACAACATTCTCAAATTCAAATGTTGAATTCATGATAGGACTTAATGATCTT |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 817295 |
Trichome-related Gene from Literature | N/A |