| Detail of EST/Unigene EV260090 |
| Acc. | EV260090 |
| Internal Acc. | MTYE368TF |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Probable plastid-lipid-associated protein 4, chloroplastic OS=Arabidopsis thaliana E-value=3e-50; Probable plastid-lipid-associated protein 5, chloroplastic OS=Arabidopsis thaliana E-value=2e-46; Probable plastid-lipid-associated protein 6, chloroplastic OS=Arabidopsis thaliana E-value=5e-07; Plastoglobulin-1, chloroplastic OS=Pisum sativum E-value=1e-06; |
| Length | 718 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_JCVI-MT1; |
| Sequence | GAAGGGAATGTTAACAAGAGGCAATTAGTGCATAAGCATGACTTATCGCTCAGCAGTTCT |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 822204 |
| Trichome-related Gene from Literature | N/A |