| Detail of EST/Unigene EV260166 |
| Acc. | EV260166 |
| Internal Acc. | MTYE458TF |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Superoxide dismutase [Cu-Zn], chloroplastic OS=Medicago sativa E-value=8e-71; Superoxide dismutase [Cu-Zn], chloroplastic OS=Pisum sativum E-value=2e-65; Superoxide dismutase [Cu-Zn], chloroplastic OS=Spinacia oleracea E-value=3e-53; Superoxide dismutase [Cu-Zn], chloroplastic OS=Solanum lycopersicum E-value=5e-52; Superoxide dismutase [Cu-Zn], chloroplastic OS=Solidago canadensis var. scabra E-value=2e-51; |
| Length | 444 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_JCVI-MT1; |
| Sequence | ACTCACTTCTCACTCTCCTCTCCGATCATCTTTCTCCGGTGTCTCCGTCAAGCTCTCTCC |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | 1.15.1.1 |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 817365 |
| Trichome-related Gene from Literature | N/A |