Detail of EST/Unigene EV260180 |
Acc. | EV260180 |
Internal Acc. | MTYE472TF |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Quinone oxidoreductase-like protein At1g23740, chloroplastic OS=Arabidopsis thaliana E-value=1e-40; Quinone-oxidoreductase homolog, chloroplastic OS=Spinacia oleracea E-value=2e-19; Putative quinone-oxidoreductase homolog, chloroplastic OS=Arabidopsis thaliana E-value=1e-18; Reticulon-4-interacting protein 1, mitochondrial OS=Mus musculus E-value=2e-15; Reticulon-4-interacting protein 1 homolog, mitochondrial OS=Danio rerio E-value=7e-15; |
Length | 677 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_JCVI-MT1; |
Sequence | GATAAACTAAAACCATTTGAGAGAAAAAAGTTCTAAGTTTTCAATATGAAAATGCAGAAA |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | 1.6.5.5 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 838984 |
Trichome-related Gene from Literature | N/A |