Detail of EST/Unigene EV260353 |
Acc. | EV260353 |
Internal Acc. | MTYE675TF |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Bifunctional phosphatase IMPL2, chloroplastic OS=Arabidopsis thaliana E-value=0; Histidinol-phosphatase OS=Chlorobaculum parvum (strain NCIB 8327) E-value=8e-27; Histidinol-phosphatase OS=Corynebacterium glutamicum (strain ATCC 13032 / DSM 20300 / JCM 1318 / LMG 3730 / NCIMB 10025) E-value=1e-22; Histidinol-phosphatase OS=Mycobacterium tuberculosis E-value=2e-21; Inositol-1-monophosphatase OS=Pasteurella multocida (strain Pm70) E-value=2e-18; |
Length | 771 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_JCVI-MT1; |
Sequence | ATATTTCAGAAAAAATAATTTTGACATTATTCACAAAAACGATCTCAGTCCTGTCACCAT |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Biosynthesis of Secondary Metabolites > ko00521 Streptomycin biosynthesis > K01092 myo-inositol-1(or 4)-monophosphatase; Metabolism > Carbohydrate Metabolism > ko00562 Inositol phosphate metabolism > K01092 myo-inositol-1(or 4)-monophosphatase; Environmental Information Processing > Signal Transduction > ko04070 Phosphatidylinositol signaling system > K01092 myo-inositol-1(or 4)-monophosphatase |
EC | 3.1.3.25 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 830067 |
Trichome-related Gene from Literature | N/A |