| Detail of EST/Unigene EV260448 |
| Acc. | EV260448 |
| Internal Acc. | MTYE781TF |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | NifU-like protein 1, chloroplastic OS=Arabidopsis thaliana E-value=2e-54; NifU-like protein 1, chloroplastic OS=Oryza sativa subsp. japonica E-value=1e-15; NifU-like protein 2, chloroplastic OS=Arabidopsis thaliana E-value=2e-14; NifU-like protein 3, chloroplastic OS=Arabidopsis thaliana E-value=7e-12; |
| Length | 770 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_JCVI-MT1; |
| Sequence | GACTCTAACTCCAATTTGTTCAATACCAACGAAACTGAATTTGAATATCCAACAAAAACA |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 828196 |
| Trichome-related Gene from Literature | N/A |