Detail of EST/Unigene EV260448 |
Acc. | EV260448 |
Internal Acc. | MTYE781TF |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | NifU-like protein 1, chloroplastic OS=Arabidopsis thaliana E-value=2e-54; NifU-like protein 1, chloroplastic OS=Oryza sativa subsp. japonica E-value=1e-15; NifU-like protein 2, chloroplastic OS=Arabidopsis thaliana E-value=2e-14; NifU-like protein 3, chloroplastic OS=Arabidopsis thaliana E-value=7e-12; |
Length | 770 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_JCVI-MT1; |
Sequence | GACTCTAACTCCAATTTGTTCAATACCAACGAAACTGAATTTGAATATCCAACAAAAACA |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 828196 |
Trichome-related Gene from Literature | N/A |