| Detail of EST/Unigene EV260546 |
| Acc. | EV260546 |
| Internal Acc. | MTYE893TF |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Thioredoxin-like 1-1, chloroplastic OS=Arabidopsis thaliana E-value=3e-82; Thioredoxin-like 1-2, chloroplastic OS=Oryza sativa subsp. japonica E-value=6e-76; Thioredoxin-like 1-1, chloroplastic OS=Oryza sativa subsp. japonica E-value=2e-72; Thioredoxin-like 1-3, chloroplastic OS=Arabidopsis thaliana E-value=2e-67; Thioredoxin-like 1-2, chloroplastic OS=Arabidopsis thaliana E-value=6e-53; |
| Length | 828 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_JCVI-MT1; |
| Sequence | CCTTTTCATCTGAGTTTCATGGCAAAAAAAGCTATCTTTCGTGTAAATAGATCAACACCC |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 837379 |
| Trichome-related Gene from Literature | N/A |