Detail of EST/Unigene EV260558 |
Acc. | EV260558 |
Internal Acc. | MTYE910TF |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Pyruvate kinase isozyme A, chloroplastic OS=Ricinus communis E-value=2e-25; Plastidial pyruvate kinase 1, chloroplastic OS=Arabidopsis thaliana E-value=3e-25; Pyruvate kinase isozyme A, chloroplastic OS=Nicotiana tabacum E-value=9e-25; Pyruvate kinase OS=Lactobacillus delbrueckii subsp. bulgaricus E-value=9e-16; Pyruvate kinase OS=Clostridium acetobutylicum (strain ATCC 824 / DSM 792 / JCM 1419 / LMG 5710 / VKM B-1787) E-value=1e-12; |
Length | 651 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_JCVI-MT1; |
Sequence | GATTGGAGTTGAACGTGTTAGAGCAACATCTGAGACCACTAGAACAACATCTCCTTTGTT |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Carbohydrate Metabolism > ko00010 Glycolysis / Gluconeogenesis > K00873 pyruvate kinase; Metabolism > Carbohydrate Metabolism > ko00620 Pyruvate metabolism > K00873 pyruvate kinase; Metabolism > Energy Metabolism > ko00710 Carbon fixation in photosynthetic organisms > K00873 pyruvate kinase; Metabolism > Nucleotide Metabolism > ko00230 Purine metabolism > K00873 pyruvate kinase |
EC | 2.7.1.40 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 821870 |
Trichome-related Gene from Literature | N/A |