Detail of EST/Unigene EV260572 |
Acc. | EV260572 |
Internal Acc. | MTYE924TF |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Probable acyl-activating enzyme 17, peroxisomal OS=Arabidopsis thaliana E-value=9e-86; Probable acyl-activating enzyme 18, peroxisomal OS=Arabidopsis thaliana E-value=7e-59; Acetyl-coenzyme A synthetase OS=Deinococcus radiodurans (strain ATCC 13939 / DSM 20539 / JCM 16871 / LMG 4051 / NBRC 15346 / NCIMB 9279 / R1 / VKM B-1422) E-value=2e-08; Acetyl-coenzyme A synthetase OS=Chlorobium tepidum (strain ATCC 49652 / DSM 12025 / TLS) E-value=4e-08; Acetyl-coenzyme A synthetase OS=Streptomyces coelicolor (strain ATCC BAA-471 / A3(2) / M145) E-value=8e-07; |
Length | 617 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_JCVI-MT1; |
Sequence | CAGGTGATCCAAAGGCAATTCCATGGACCAATATTACTCCTCTAAAAGCTGCTGCAGATG |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Carbohydrate Metabolism > ko00010 Glycolysis / Gluconeogenesis > K01895 acetyl-CoA synthetase; Metabolism > Carbohydrate Metabolism > ko00640 Propanoate metabolism > K01895 acetyl-CoA synthetase; Metabolism > Carbohydrate Metabolism > ko00620 Pyruvate metabolism > K01895 acetyl-CoA synthetase; Metabolism > Energy Metabolism > ko00720 Reductive carboxylate cycle (CO2 fixation) > K01895 acetyl-CoA synthetase |
EC | 6.2.1.1 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 832369 |
Trichome-related Gene from Literature | N/A |