Detail of EST/Unigene EV260595 |
Acc. | EV260595 |
Internal Acc. | MTYE949TF |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Calvin cycle protein CP12-2, chloroplastic OS=Arabidopsis thaliana E-value=2e-31; Calvin cycle protein CP12-1, chloroplastic OS=Arabidopsis thaliana E-value=2e-27; Calvin cycle protein CP12, chloroplastic OS=Chlamydomonas reinhardtii E-value=2e-15; Calvin cycle protein CP12-3, chloroplastic OS=Arabidopsis thaliana E-value=3e-12; |
Length | 641 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_JCVI-MT1; |
Sequence | TGGTGTGAGTCTTTCAAGCCCTAGAGTAATTTTCAAGGGACCAGAGTCTCTTCAAAAGTC |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 825414 |
Trichome-related Gene from Literature | N/A |