Detail of EST/Unigene EV260636 |
Acc. | EV260636 |
Internal Acc. | MTYE995TF |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Ribosomal protein S3, mitochondrial OS=Petunia hybrida E-value=0; Ribosomal protein S3, mitochondrial OS=Oenothera berteriana E-value=0; Ribosomal protein S3, mitochondrial OS=Arabidopsis thaliana E-value=0; Ribosomal protein S3, mitochondrial OS=Zea mays E-value=1e-99; Ribosomal protein S3, mitochondrial OS=Brassica napus E-value=3e-97; |
Length | 771 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_JCVI-MT1; |
Sequence | AAGAAAGACGAAGAACGAAACGAAGTGAGAGGCCGGAGGGCAGGGAAAAGAGTCGAGTCG |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | N/A |
Trichome-related Gene from Literature | N/A |