| Detail of EST/Unigene EV260636 |
| Acc. | EV260636 |
| Internal Acc. | MTYE995TF |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Ribosomal protein S3, mitochondrial OS=Petunia hybrida E-value=0; Ribosomal protein S3, mitochondrial OS=Oenothera berteriana E-value=0; Ribosomal protein S3, mitochondrial OS=Arabidopsis thaliana E-value=0; Ribosomal protein S3, mitochondrial OS=Zea mays E-value=1e-99; Ribosomal protein S3, mitochondrial OS=Brassica napus E-value=3e-97; |
| Length | 771 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_JCVI-MT1; |
| Sequence | AAGAAAGACGAAGAACGAAACGAAGTGAGAGGCCGGAGGGCAGGGAAAAGAGTCGAGTCG |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | N/A |
| Trichome-related Gene from Literature | N/A |