Detail of EST/Unigene EV260699 |
Acc. | EV260699 |
Internal Acc. | MTYEA71TF |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Replication factor C subunit 4 OS=Homo sapiens E-value=8e-74; Replication factor C subunit 4 OS=Mus musculus E-value=6e-72; Probable replication factor C subunit 4 OS=Dictyostelium discoideum E-value=1e-71; Replication factor C subunit 2 OS=Phaeosphaeria nodorum (strain SN15 / ATCC MYA-4574 / FGSC 10173) E-value=5e-71; Replication factor C subunit 2 OS=Saccharomyces cerevisiae (strain ATCC 204508 / S288c) E-value=9e-70; |
Length | 745 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_JCVI-MT1; |
Sequence | GAGCAGAGAATCGTGTGTGAAGAGAAAATTACTAATATGGCGCCAATCATTCAGAGCACT |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Genetic Information Processing > Replication and Repair > ko03030 DNA replication > K10755 replication factor C subunit 2/4; Genetic Information Processing > Replication and Repair > ko03430 Mismatch repair > K10755 replication factor C subunit 2/4; Genetic Information Processing > Replication and Repair > ko03420 Nucleotide excision repair > K10755 replication factor C subunit 2/4 |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 838771 |
Trichome-related Gene from Literature | N/A |