Detail of EST/Unigene EV260708 |
Acc. | EV260708 |
Internal Acc. | MTYEA82TF |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | PsbP-like protein 2, chloroplastic OS=Arabidopsis thaliana E-value=6e-70; PsbP-like protein 1, chloroplastic OS=Arabidopsis thaliana E-value=1e-30; Oxygen-evolving enhancer protein 2, chloroplastic OS=Narcissus pseudonarcissus E-value=3e-06; Oxygen-evolving enhancer protein 2, chloroplastic OS=Spinacia oleracea E-value=7e-06; Oxygen-evolving enhancer protein 2-1, chloroplastic OS=Arabidopsis thaliana E-value=7e-06; |
Length | 751 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_JCVI-MT1; |
Sequence | GGACTATCCACTCAGTATTTCTTTCCATCTCAAAACTGAAGCTCTATACCACTCTTCTTC |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 818532 |
Trichome-related Gene from Literature | N/A |