| Detail of EST/Unigene EV260708 |
| Acc. | EV260708 |
| Internal Acc. | MTYEA82TF |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | PsbP-like protein 2, chloroplastic OS=Arabidopsis thaliana E-value=6e-70; PsbP-like protein 1, chloroplastic OS=Arabidopsis thaliana E-value=1e-30; Oxygen-evolving enhancer protein 2, chloroplastic OS=Narcissus pseudonarcissus E-value=3e-06; Oxygen-evolving enhancer protein 2, chloroplastic OS=Spinacia oleracea E-value=7e-06; Oxygen-evolving enhancer protein 2-1, chloroplastic OS=Arabidopsis thaliana E-value=7e-06; |
| Length | 751 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_JCVI-MT1; |
| Sequence | GGACTATCCACTCAGTATTTCTTTCCATCTCAAAACTGAAGCTCTATACCACTCTTCTTC |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 818532 |
| Trichome-related Gene from Literature | N/A |