| Detail of EST/Unigene EV260716 |
| Acc. | EV260716 |
| Internal Acc. | MTYEA92TF |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Acetate/butyrate--CoA ligase AAE7, peroxisomal OS=Arabidopsis thaliana E-value=0; Probable acyl-activating enzyme 2 OS=Arabidopsis thaliana E-value=5e-52; Probable acyl-activating enzyme 1, peroxisomal OS=Arabidopsis thaliana E-value=2e-49; Benzoate--CoA ligase, peroxisomal OS=Arabidopsis thaliana E-value=2e-49; Probable acyl-activating enzyme 6 OS=Arabidopsis thaliana E-value=4e-48; |
| Length | 775 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_JCVI-MT1; |
| Sequence | TTACACACACACGGAACGGAAGAACGCAGTGGCGATGGGTACGAGACAAGACATAGACGA |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Metabolism > Carbohydrate Metabolism > ko00010 Glycolysis / Gluconeogenesis > K01895 acetyl-CoA synthetase; Metabolism > Carbohydrate Metabolism > ko00640 Propanoate metabolism > K01895 acetyl-CoA synthetase; Metabolism > Carbohydrate Metabolism > ko00620 Pyruvate metabolism > K01895 acetyl-CoA synthetase; Metabolism > Energy Metabolism > ko00720 Reductive carboxylate cycle (CO2 fixation) > K01895 acetyl-CoA synthetase |
| EC | 6.2.1.1 |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 820946 |
| Trichome-related Gene from Literature | N/A |