Detail of EST/Unigene EV260716 |
Acc. | EV260716 |
Internal Acc. | MTYEA92TF |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Acetate/butyrate--CoA ligase AAE7, peroxisomal OS=Arabidopsis thaliana E-value=0; Probable acyl-activating enzyme 2 OS=Arabidopsis thaliana E-value=5e-52; Probable acyl-activating enzyme 1, peroxisomal OS=Arabidopsis thaliana E-value=2e-49; Benzoate--CoA ligase, peroxisomal OS=Arabidopsis thaliana E-value=2e-49; Probable acyl-activating enzyme 6 OS=Arabidopsis thaliana E-value=4e-48; |
Length | 775 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_JCVI-MT1; |
Sequence | TTACACACACACGGAACGGAAGAACGCAGTGGCGATGGGTACGAGACAAGACATAGACGA |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Carbohydrate Metabolism > ko00010 Glycolysis / Gluconeogenesis > K01895 acetyl-CoA synthetase; Metabolism > Carbohydrate Metabolism > ko00640 Propanoate metabolism > K01895 acetyl-CoA synthetase; Metabolism > Carbohydrate Metabolism > ko00620 Pyruvate metabolism > K01895 acetyl-CoA synthetase; Metabolism > Energy Metabolism > ko00720 Reductive carboxylate cycle (CO2 fixation) > K01895 acetyl-CoA synthetase |
EC | 6.2.1.1 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 820946 |
Trichome-related Gene from Literature | N/A |