Detail of EST/Unigene EV260752 |
Acc. | EV260752 |
Internal Acc. | MTYEB37TF |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Ferredoxin--NADP reductase, leaf isozyme, chloroplastic OS=Pisum sativum E-value=6e-54; Ferredoxin--NADP reductase, chloroplastic OS=Vicia faba E-value=2e-52; Ferredoxin--NADP reductase, leaf isozyme 1, chloroplastic OS=Arabidopsis thaliana E-value=3e-50; Ferredoxin--NADP reductase, chloroplastic OS=Mesembryanthemum crystallinum E-value=1e-49; Ferredoxin--NADP reductase, chloroplastic OS=Spinacia oleracea E-value=2e-49; |
Length | 525 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_JCVI-MT1; |
Sequence | ATAAGGAGGAATTTGAAAAGATGAAGGAGAAAGCGCCTGAGAACTTCAGGCTCGACTTTG |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 836751 |
Trichome-related Gene from Literature | N/A |