| Detail of EST/Unigene EV260779 |
| Acc. | EV260779 |
| Internal Acc. | MTYEB68TF |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Glucan endo-1,3-beta-glucosidase OS=Vitis vinifera E-value=5e-68; Glucan endo-1,3-beta-glucosidase OS=Nicotiana tabacum E-value=5e-65; Glucan endo-1,3-beta-glucosidase, acidic isoform GI9 OS=Nicotiana tabacum E-value=7e-65; Glucan endo-1,3-beta-glucosidase OS=Nicotiana tabacum E-value=2e-62; Glucan endo-1,3-beta-glucosidase (Fragment) OS=Glycine max E-value=2e-62; |
| Length | 837 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_JCVI-MT1; |
| Sequence | GATAGCTGCATACTTGGTTTATACTTTGGTATAATTAAAGCAATACATTCTTAAAAAGAA |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 827320 |
| Trichome-related Gene from Literature | N/A |