| Detail of EST/Unigene EV260981 |
| Acc. | EV260981 |
| Internal Acc. | MTYEE19TF |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | 30S ribosomal protein S3, chloroplastic OS=Lotus japonicus E-value=1e-44; 30S ribosomal protein S3, chloroplastic OS=Glycine max E-value=2e-42; 30S ribosomal protein S3, chloroplastic OS=Olimarabidopsis pumila E-value=1e-40; 30S ribosomal protein S3, chloroplastic OS=Nasturtium officinale E-value=1e-40; 30S ribosomal protein S3, chloroplastic OS=Capsella bursa-pastoris E-value=1e-40; |
| Length | 748 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_JCVI-MT1; |
| Sequence | GACTCATTTCATTTTTTCGTGAAAATATAACCTTAGGAGAAAGCAGAACCAATACATAGA |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | N/A |
| Trichome-related Gene from Literature | N/A |