| Detail of EST/Unigene EV261191 |
| Acc. | EV261191 |
| Internal Acc. | MTYEG66TF |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Nudix hydrolase 18, mitochondrial OS=Arabidopsis thaliana E-value=3e-58; Nudix hydrolase 17, mitochondrial OS=Arabidopsis thaliana E-value=4e-57; Nudix hydrolase 4 OS=Arabidopsis thaliana E-value=5e-56; Nudix hydrolase 21, chloroplastic OS=Arabidopsis thaliana E-value=2e-50; Nudix hydrolase 16, mitochondrial OS=Arabidopsis thaliana E-value=3e-36; |
| Length | 781 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_JCVI-MT1; |
| Sequence | GATCCACTCAACAAAACTCTCATTCGTTTCTTAAACTCTCTGTTTCATTATTCTTTACAA |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | 3.6.1.52 |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 838051 |
| Trichome-related Gene from Literature | N/A |