Detail of EST/Unigene EV261210 |
Acc. | EV261210 |
Internal Acc. | MTYEG86TF |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Probable alpha-galactosidase B OS=Talaromyces emersonii E-value=1e-09; Probable alpha-galactosidase B OS=Neosartorya fumigata (strain CEA10 / CBS 144.89 / FGSC A1163) E-value=2e-09; Probable alpha-galactosidase B OS=Neosartorya fischeri (strain ATCC 1020 / DSM 3700 / FGSC A1164 / NRRL 181) E-value=7e-09; Probable alpha-galactosidase B OS=Aspergillus niger E-value=7e-09; Probable alpha-galactosidase B OS=Aspergillus niger (strain CBS 513.88 / FGSC A1513) E-value=7e-09; |
Length | 875 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_JCVI-MT1; |
Sequence | GGTGCAACCCTTGAAACAAGGTAACAAAACCGTACCATGAGGGGTTTTACACTGTGCTTG |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Carbohydrate Metabolism > ko00052 Galactose metabolism > K01189 alpha-galactosidase; Metabolism > Lipid Metabolism > ko00561 Glycerolipid metabolism > K01189 alpha-galactosidase; Metabolism > Lipid Metabolism > ko00600 Sphingolipid metabolism > K01189 alpha-galactosidase; Metabolism > Glycan Biosynthesis and Metabolism > ko00603 Glycosphingolipid biosynthesis - globoseries > K01189 alpha-galactosidase; Metabolism > Glycan Biosynthesis and Metabolism > ko00603 Glycosphingolipid biosynthesis - globoseries > K01204 alpha-N-acetylgalactosaminidase |
EC | 3.2.1.22 3.2.1.49 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 822242 |
Trichome-related Gene from Literature | N/A |