Detail of EST/Unigene EV261425 |
Acc. | EV261425 |
Internal Acc. | MTYEJ38TF |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Carbamoyl-phosphate synthase small chain OS=Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961) E-value=2e-37; Carbamoyl-phosphate synthase small chain OS=Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633) E-value=5e-37; Carbamoyl-phosphate synthase small chain OS=Vibrio vulnificus (strain YJ016) E-value=1e-36; Carbamoyl-phosphate synthase small chain OS=Vibrio vulnificus (strain CMCP6) E-value=1e-36; Carbamoyl-phosphate synthase small chain OS=Teredinibacter turnerae (strain ATCC 39867 / T7901) E-value=1e-36; |
Length | 755 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_JCVI-MT1; |
Sequence | GGCGCTTCTTCTGTTAATCACCGAATCCTCTGTTAATCACCCCACTCTCTCGCAGCTCGC |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Nucleotide Metabolism > ko00240 Pyrimidine metabolism > K11540 carbamoyl-phosphate synthase / aspartate carbamoyltransferase / dihydroorotase; Metabolism > Amino Acid Metabolism > ko00252 Alanine and aspartate metabolism > K11540 carbamoyl-phosphate synthase / aspartate carbamoyltransferase / dihydroorotase; Metabolism > Amino Acid Metabolism > ko00251 Glutamate metabolism > K11540 carbamoyl-phosphate synthase / aspartate carbamoyltransferase / dihydroorotase |
EC | 2.1.3.2 3.5.2.3 6.3.5.5 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 822396 |
Trichome-related Gene from Literature | N/A |