| Detail of EST/Unigene EV261598 |
| Acc. | EV261598 |
| Internal Acc. | MTYEL45TF |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Dihydroflavonol-4-reductase OS=Petunia hybrida E-value=5e-31; Anthocyanidin reductase OS=Arabidopsis thaliana E-value=7e-31; Dihydroflavonol-4-reductase OS=Gerbera hybrida E-value=9e-30; Dihydroflavonol-4-reductase OS=Solanum lycopersicum E-value=5e-27; Dihydroflavonol-4-reductase OS=Arabidopsis thaliana E-value=9e-27; |
| Length | 809 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_JCVI-MT1; |
| Sequence | GAGAGTATCATCAGTGATGATGGAAAGGAGGTGCAAGGTGTGTGTTACAGGTGGTGCTGG |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Metabolism > Lipid Metabolism > ko00150 Androgen and estrogen metabolism > K00070 3beta-hydroxy-delta5-steroid dehydrogenase; Metabolism > Lipid Metabolism > ko00140 C21-Steroid hormone metabolism > K00070 3beta-hydroxy-delta5-steroid dehydrogenase; Metabolism > Lipid Metabolism > ko00100 Biosynthesis of steroids > K07748 sterol-4alpha-carboxylate 3-dehydrogenase (decarboxylating) |
| EC | 1.1.1.170 |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 828833 |
| Trichome-related Gene from Literature | N/A |