Detail of EST/Unigene EV261639 |
Acc. | EV261639 |
Internal Acc. | MTYEL95TF |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Ribulose-phosphate 3-epimerase, chloroplastic (Fragment) OS=Solanum tuberosum E-value=5e-87; Ribulose-phosphate 3-epimerase, chloroplastic OS=Spinacia oleracea E-value=1e-86; Ribulose-phosphate 3-epimerase, chloroplastic OS=Oryza sativa subsp. japonica E-value=9e-81; Ribulose-phosphate 3-epimerase OS=Synechocystis sp. (strain PCC 6803 / Kazusa) E-value=4e-54; Ribulose-phosphate 3-epimerase OS=Bacillus subtilis (strain 168) E-value=3e-48; |
Length | 654 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_JCVI-MT1; |
Sequence | GGACACACTTTGTGAAAAGGAGAAAAGTTCCAAATTCAAAGCACAAGACAAGATGGCTTC |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Carbohydrate Metabolism > ko00040 Pentose and glucuronate interconversions > K01783 ribulose-phosphate 3-epimerase; Metabolism > Carbohydrate Metabolism > ko00030 Pentose phosphate pathway > K01783 ribulose-phosphate 3-epimerase; Metabolism > Energy Metabolism > ko00710 Carbon fixation in photosynthetic organisms > K01783 ribulose-phosphate 3-epimerase |
EC | 5.1.3.1 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 836262 |
Trichome-related Gene from Literature | N/A |