Detail of EST/Unigene EV261648 |
Acc. | EV261648 |
Internal Acc. | MTYEM08TF |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Probable beta-1,3-galactosyltransferase 11 OS=Arabidopsis thaliana E-value=2e-52; Probable beta-1,3-galactosyltransferase 9 OS=Arabidopsis thaliana E-value=1e-21; Probable beta-1,3-galactosyltransferase 10 OS=Arabidopsis thaliana E-value=4e-21; Probable beta-1,3-galactosyltransferase 3 OS=Arabidopsis thaliana E-value=2e-11; Probable beta-1,3-galactosyltransferase 1 OS=Arabidopsis thaliana E-value=2e-11; |
Length | 543 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_JCVI-MT1; |
Sequence | GAGAAGCAAGCAAAGAAAGAGTCTCTCTCGCATAACAACATTGTTGAACAGAATTGGATT |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 835415 |
Trichome-related Gene from Literature | N/A |