Detail of EST/Unigene EV261736 |
Acc. | EV261736 |
Internal Acc. | MTYEN15TF |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Methionine aminopeptidase 1B, chloroplastic OS=Arabidopsis thaliana E-value=1e-82; Methionine aminopeptidase 1C, chloroplastic/mitochondrial OS=Arabidopsis thaliana E-value=2e-67; Methionine aminopeptidase 1D, chloroplastic/mitochondrial OS=Arabidopsis thaliana E-value=7e-61; Methionine aminopeptidase 1D, mitochondrial OS=Dictyostelium discoideum E-value=4e-45; Methionine aminopeptidase 1D, mitochondrial OS=Mus musculus E-value=2e-43; |
Length | 698 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_JCVI-MT1; |
Sequence | GCTCACTGCTTCGCTCGGACACTCTGCATTTCTCCAACTCTCTACTTCCTTTTATGGCGA |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | 3.4.11.18 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 837887 |
Trichome-related Gene from Literature | N/A |