| Detail of EST/Unigene EV261788 |
| Acc. | EV261788 |
| Internal Acc. | MTYEN76TF |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Aspartate carbamoyltransferase 2, chloroplastic OS=Pisum sativum E-value=3e-86; Aspartate carbamoyltransferase 3, chloroplastic OS=Pisum sativum E-value=5e-85; Aspartate carbamoyltransferase 1, chloroplastic OS=Pisum sativum E-value=9e-79; Aspartate carbamoyltransferase, chloroplastic OS=Arabidopsis thaliana E-value=2e-76; Aspartate carbamoyltransferase OS=Methanocaldococcus jannaschii (strain ATCC 43067 / DSM 2661 / JAL-1 / JCM 10045 / NBRC 100440) E-value=1e-45; |
| Length | 767 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_JCVI-MT1; |
| Sequence | GGCGAGATTAATTGAGAAGATTGTCTTCTCTTCTCAATTTCACAGTTTTGCAGTTCACAC |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Metabolism > Nucleotide Metabolism > ko00240 Pyrimidine metabolism > K11540 carbamoyl-phosphate synthase / aspartate carbamoyltransferase / dihydroorotase; Metabolism > Amino Acid Metabolism > ko00252 Alanine and aspartate metabolism > K11540 carbamoyl-phosphate synthase / aspartate carbamoyltransferase / dihydroorotase; Metabolism > Amino Acid Metabolism > ko00251 Glutamate metabolism > K11540 carbamoyl-phosphate synthase / aspartate carbamoyltransferase / dihydroorotase |
| EC | 2.1.3.2 3.5.2.3 6.3.4.16 6.3.5.5 |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 821577 |
| Trichome-related Gene from Literature | N/A |