Detail of EST/Unigene EV261844 |
Acc. | EV261844 |
Internal Acc. | MTYEO44TF |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Elongation factor Tu, chloroplastic OS=Pisum sativum E-value=2e-97; Elongation factor Tu, chloroplastic OS=Glycine max E-value=1e-95; Elongation factor Tu, chloroplastic OS=Arabidopsis thaliana E-value=4e-94; Elongation factor TuB, chloroplastic OS=Nicotiana sylvestris E-value=6e-93; Elongation factor Tu, chloroplastic OS=Glycine max E-value=6e-93; |
Length | 764 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_JCVI-MT1; |
Sequence | GAAAAACAAATCCTCTTCTCTTCACTCTCAATTCAACTATGGCAATTTCAATTTCTTCTT |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | 3.6.5.3 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 827784 |
Trichome-related Gene from Literature | N/A |