Detail of EST/Unigene EV261966 |
Acc. | EV261966 |
Internal Acc. | MTYEP88TF |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | 50S ribosomal protein L23, chloroplastic OS=Glycine max E-value=2e-41; 50S ribosomal protein L23, chloroplastic OS=Phaseolus angularis E-value=2e-41; 50S ribosomal protein L23, chloroplastic OS=Coffea arabica E-value=2e-40; 50S ribosomal protein L23, chloroplastic OS=Vitis vinifera E-value=2e-39; 50S ribosomal protein L23, chloroplastic OS=Cucumis sativus E-value=2e-39; |
Length | 871 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_JCVI-MT1; |
Sequence | ATGCACGCCAATAGAACCCTACCTCCCATAAAGTCGATTTTTGTTCAAGAATGAATCAAT |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | N/A |
Trichome-related Gene from Literature | N/A |