| Detail of EST/Unigene EV261966 |
| Acc. | EV261966 |
| Internal Acc. | MTYEP88TF |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | 50S ribosomal protein L23, chloroplastic OS=Glycine max E-value=2e-41; 50S ribosomal protein L23, chloroplastic OS=Phaseolus angularis E-value=2e-41; 50S ribosomal protein L23, chloroplastic OS=Coffea arabica E-value=2e-40; 50S ribosomal protein L23, chloroplastic OS=Vitis vinifera E-value=2e-39; 50S ribosomal protein L23, chloroplastic OS=Cucumis sativus E-value=2e-39; |
| Length | 871 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_JCVI-MT1; |
| Sequence | ATGCACGCCAATAGAACCCTACCTCCCATAAAGTCGATTTTTGTTCAAGAATGAATCAAT |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | N/A |
| Trichome-related Gene from Literature | N/A |