Detail of EST/Unigene EV261970 |
Acc. | EV261970 |
Internal Acc. | MTYEP92TF |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Thioredoxin M-type, chloroplastic OS=Pisum sativum E-value=2e-33; Thioredoxin M-type, chloroplastic OS=Spinacia oleracea E-value=3e-32; Thioredoxin M5, chloroplastic OS=Oryza sativa subsp. japonica E-value=9e-29; Thioredoxin M-type, chloroplastic OS=Zea mays E-value=1e-27; Thioredoxin M-type, chloroplastic OS=Triticum aestivum E-value=3e-26; |
Length | 530 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_JCVI-MT1; |
Sequence | GAGATTTCAAACCAAACAAATTAAAAACCACCAAAACACTAGAAGCTTATCCACAAGTGC |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 839436 |
Trichome-related Gene from Literature | N/A |