Detail of EST/Unigene EV262047 |
Acc. | EV262047 |
Internal Acc. | MTYEQ82TF |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Protein LUTEIN DEFICIENT 5, chloroplastic OS=Arabidopsis thaliana E-value=0; Carotene epsilon-monooxygenase, chloroplastic OS=Arabidopsis thaliana E-value=9e-71; Cytochrome P450 97B2, chloroplastic OS=Glycine max E-value=2e-60; Cytochrome P450 97B1, chloroplastic OS=Pisum sativum E-value=9e-58; Cytochrome P450 97B3, chloroplastic OS=Arabidopsis thaliana E-value=7e-57; |
Length | 760 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_JCVI-MT1; |
Sequence | CGAAGCATTTCTCCAATTCCAGTCTGGGATCTCCCAATATGGAAAGACATATCCCCGCGT |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | 1.14.-.- |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 840067 |
Trichome-related Gene from Literature | N/A |