Detail of EST/Unigene EV262265 |
Acc. | EV262265 |
Internal Acc. | MTYET40TF |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Peroxiredoxin Q, chloroplastic (Fragment) OS=Sedum lineare E-value=1e-73; Peroxiredoxin Q, chloroplastic OS=Populus jackii E-value=3e-73; Peroxiredoxin Q, chloroplastic OS=Suaeda salsa E-value=3e-71; Peroxiredoxin Q, chloroplastic OS=Gentiana triflora E-value=1e-70; Peroxiredoxin Q, chloroplastic OS=Arabidopsis thaliana E-value=2e-70; |
Length | 823 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_JCVI-MT1; |
Sequence | GACCCCATAAGGAAAAGAAAACACAACACAACACAACATGTTATCACTTTGTTCTTCCTC |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | 1.11.1.15 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | N/A |
Trichome-related Gene from Literature | N/A |