Detail of EST/Unigene EV262325 |
Acc. | EV262325 |
Internal Acc. | MTYEU15TF |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Alpha-1,4-glucan-protein synthase [UDP-forming] OS=Pisum sativum E-value=0; UDP-arabinopyranose mutase 3 OS=Arabidopsis thaliana E-value=0; Alpha-1,4-glucan-protein synthase [UDP-forming] 1 OS=Solanum tuberosum E-value=0; Alpha-1,4-glucan-protein synthase [UDP-forming] 2 OS=Solanum tuberosum E-value=0; Alpha-1,4-glucan-protein synthase [UDP-forming] OS=Zea mays E-value=0; |
Length | 732 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_JCVI-MT1; |
Sequence | TTCTTCATCCAAACCAACACCACTTCTCAAAGATGAACTCGACATCGTTATCCCAACCAT |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 820039 |
Trichome-related Gene from Literature | 820039 |