Detail of EST/Unigene EV262621 |
Acc. | EV262621 |
Internal Acc. | MTYEX93TF |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Alanine aminotransferase 1, mitochondrial OS=Arabidopsis thaliana E-value=5e-90; Alanine aminotransferase 2, mitochondrial OS=Arabidopsis thaliana E-value=3e-89; Alanine aminotransferase 2 OS=Panicum miliaceum E-value=2e-83; Alanine aminotransferase 2 OS=Hordeum vulgare E-value=3e-79; Probable alanine aminotransferase OS=Saccharomyces cerevisiae (strain ATCC 204508 / S288c) E-value=3e-44; |
Length | 798 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_JCVI-MT1; |
Sequence | GACACACCCACGTTACTTTTCAACTTCGCATCAAAAAACAAAACCATCTTTCTCACAATA |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Energy Metabolism > ko00710 Carbon fixation in photosynthetic organisms > K00814 alanine transaminase; Metabolism > Amino Acid Metabolism > ko00252 Alanine and aspartate metabolism > K00814 alanine transaminase; Metabolism > Amino Acid Metabolism > ko00251 Glutamate metabolism > K00814 alanine transaminase |
EC | 2.6.1.2 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 838301 |
Trichome-related Gene from Literature | N/A |