Detail of EST/Unigene EV262775 |
Acc. | EV262775 |
Internal Acc. | MTYEZ68TF |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Acetolactate synthase 3, chloroplastic OS=Brassica napus E-value=0; Acetolactate synthase 1, chloroplastic OS=Brassica napus E-value=0; Acetolactate synthase 1, chloroplastic OS=Nicotiana tabacum SURA E-value=0; Acetolactate synthase 2, chloroplastic OS=Nicotiana tabacum SURB E-value=0; Acetolactate synthase, chloroplastic OS=Arabidopsis thaliana 1.2 E-value=0; |
Length | 815 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_JCVI-MT1; |
Sequence | TATGCTATTCAGGTGCTTGATGAGTTGACGAATGGTGACGCTATTGTTAGTACTGGTGTT |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | 4.1.-.- |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 824015 |
Trichome-related Gene from Literature | N/A |