| Detail of EST/Unigene EV262841 |
| Acc. | EV262841 |
| Internal Acc. | MTYF043TF |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Coiled-coil domain-containing protein 90B, mitochondrial OS=Homo sapiens E-value=2e-19; Coiled-coil domain-containing protein 90B, mitochondrial OS=Mus musculus E-value=4e-19; Coiled-coil domain-containing protein 90B, mitochondrial OS=Rattus norvegicus E-value=3e-18; Coiled-coil domain-containing protein 90B, mitochondrial OS=Xenopus tropicalis E-value=7e-18; Coiled-coil domain-containing protein 90A, mitochondrial OS=Xenopus tropicalis E-value=2e-16; |
| Length | 808 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_JCVI-MT1; |
| Sequence | GGAGTAGTACTAGTTGAGAAAGCTTGTTTCTCTCTCTCTCTCTCTCTCTCTCTCTCTGGA |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 816144 |
| Trichome-related Gene from Literature | N/A |