Detail of EST/Unigene EV262841 |
Acc. | EV262841 |
Internal Acc. | MTYF043TF |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Coiled-coil domain-containing protein 90B, mitochondrial OS=Homo sapiens E-value=2e-19; Coiled-coil domain-containing protein 90B, mitochondrial OS=Mus musculus E-value=4e-19; Coiled-coil domain-containing protein 90B, mitochondrial OS=Rattus norvegicus E-value=3e-18; Coiled-coil domain-containing protein 90B, mitochondrial OS=Xenopus tropicalis E-value=7e-18; Coiled-coil domain-containing protein 90A, mitochondrial OS=Xenopus tropicalis E-value=2e-16; |
Length | 808 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_JCVI-MT1; |
Sequence | GGAGTAGTACTAGTTGAGAAAGCTTGTTTCTCTCTCTCTCTCTCTCTCTCTCTCTCTGGA |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 816144 |
Trichome-related Gene from Literature | N/A |