| Detail of EST/Unigene EW700856 |
| Acc. | EW700856 |
| Internal Acc. | EST00596 |
| Type | Singleton/Unigene |
| Annotation (Top 5 hits in Uniprot_trembl) | Chlorophyll a-b binding protein 3, chloroplastic OS=Glycine max E-value=0; Chlorophyll a-b binding protein of LHCII type I, chloroplastic (Fragment) OS=Cucumis sativus E-value=0; Chlorophyll a-b binding protein 3C, chloroplastic OS=Solanum lycopersicum E-value=0; Chlorophyll a-b binding protein 40, chloroplastic OS=Nicotiana tabacum E-value=0; Chlorophyll a-b binding protein 16, chloroplastic OS=Nicotiana tabacum E-value=0; |
| Length | 748 nt |
| Species | Cannabis sativa |
| Belonged EST Libraries | LIBEST_019973 (1 ESTs); |
| Sequence | ATTTTTTTCCTCTCTTTTTCAAATTCTCAACCAACCATGTCTGCCTCTTCCACCATGGCT |
| EST members of Unigene | EW700856 |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 839871 |
| Trichome-related Gene from Literature | 839871 |