Detail of EST/Unigene EW701054 |
Acc. | EW701054 |
Internal Acc. | EST00794 |
Type | Singleton/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | Phytoene dehydrogenase, chloroplastic/chromoplastic OS=Glycine max E-value=0; 15-cis-phytoene desaturase, chloroplastic/chromoplastic OS=Arabidopsis thaliana E-value=0; Phytoene dehydrogenase, chloroplastic/chromoplastic OS=Solanum lycopersicum E-value=0; Phytoene dehydrogenase, chloroplastic/chromoplastic OS=Oryza sativa subsp. japonica E-value=0; Phytoene dehydrogenase, chloroplastic/chromoplastic OS=Oryza sativa subsp. indica E-value=0; |
Length | 719 nt |
Species | Cannabis sativa |
Belonged EST Libraries | LIBEST_019973 (1 ESTs); |
Sequence | GAACAATGAGATGCTGACCTGGGCAGAAAAAGTCAAATTTGCAATTGGGCTTCTGCCTGC |
EST members of Unigene | EW701054 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 827061 |
Trichome-related Gene from Literature | 827061 |