| Detail of EST/Unigene EW701212 |
| Acc. | EW701212 |
| Internal Acc. | EST00952 |
| Type | Singleton/Unigene |
| Annotation (Top 5 hits in Uniprot_trembl) | Omega-3 fatty acid desaturase, chloroplastic OS=Sesamum indicum E-value=2e-51; Omega-3 fatty acid desaturase, chloroplastic OS=Glycine max E-value=1e-47; Omega-3 fatty acid desaturase, chloroplastic OS=Ricinus communis E-value=2e-46; Omega-3 fatty acid desaturase, chloroplastic OS=Arabidopsis thaliana E-value=3e-42; Temperature-sensitive omega-3 fatty acid desaturase, chloroplastic OS=Arabidopsis thaliana E-value=8e-42; |
| Length | 707 nt |
| Species | Cannabis sativa |
| Belonged EST Libraries | LIBEST_019973 (1 ESTs); |
| Sequence | CAACAACAAGCACAAGTTGTGATTTTTTTTTATTCTTTCTCTTCTTTGGAGTTGAGGAGA |
| EST members of Unigene | EW701212 |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 820288 |
| Trichome-related Gene from Literature | 820288 |