| Detail of EST/Unigene EW701769 |
| Acc. | EW701769 |
| Internal Acc. | EST01509 |
| Type | Singleton/Unigene |
| Annotation (Top 5 hits in Uniprot_trembl) | Glutathione S-transferase APIC OS=Nicotiana tabacum E-value=2e-25; Glutathione S-transferase PARB OS=Nicotiana tabacum E-value=4e-25; Glutathione S-transferase OS=Hyoscyamus muticus E-value=1e-24; Glutathione S-transferase F2 OS=Arabidopsis thaliana E-value=3e-22; Glutathione S-transferase F3 OS=Arabidopsis thaliana E-value=3e-22; |
| Length | 292 nt |
| Species | Cannabis sativa |
| Belonged EST Libraries | LIBEST_019973 (1 ESTs); |
| Sequence | CTCCTTTTCACTACGAAAAATGGCACCCATCAAAGTCCACGGCTCAGCCTACTCAACTGC |
| EST members of Unigene | EW701769 |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Metabolism > Xenobiotics Biodegradation and Metabolism > ko00982 Drug metabolism - cytochrome P450 > K00799 glutathione S-transferase; Metabolism > Xenobiotics Biodegradation and Metabolism > ko00980 Metabolism of xenobiotics by cytochrome P450 > K00799 glutathione S-transferase; Metabolism > Metabolism of Other Amino Acids > ko00480 Glutathione metabolism > K00799 glutathione S-transferase |
| EC | 2.5.1.18 |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 827931 |
| Trichome-related Gene from Literature | 827931 |