| Detail of EST/Unigene EX521524 |
| Acc. | EX521524 |
| Internal Acc. | HopsCTAB-33R_2007-06-28/Hops-CTAB-33R_D07_029_1 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Glucan endo-1,3-beta-glucosidase, basic vacuolar isoform OS=Hevea brasiliensis E-value=3e-47; Lichenase OS=Nicotiana plumbaginifolia E-value=1e-42; Glucan endo-1,3-beta-glucosidase, basic isoform 3 (Fragment) OS=Solanum tuberosum E-value=4e-42; Glucan endo-1,3-beta-glucosidase, basic isoform 1 (Fragment) OS=Solanum tuberosum E-value=4e-42; Glucan endo-1,3-beta-glucosidase, basic isoform 2 OS=Solanum tuberosum E-value=1e-41; |
| Length | 575 nt |
| Species | Humulus lupulus |
| Belonged EST Libraries | HL_TRI; |
| Sequence | ACCAAAACCTATTTGATGCAATATTGGATGCATTGTACTCTTCTCTTGAGGGGGCTTGGG |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 824893 |
| Trichome-related Gene from Literature | 824893 |