Detail of EST/Unigene EX523324 |
Acc. | EX523324 |
Internal Acc. | ALF-R-10_2007-07-21_1/ALF(R)-10_O12_017_1 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Lipid phosphate phosphatase 2 OS=Arabidopsis thaliana E-value=0; Putative lipid phosphate phosphatase 3, chloroplastic OS=Arabidopsis thaliana E-value=2e-94; Lipid phosphate phosphatase 1 OS=Arabidopsis thaliana E-value=4e-85; Phosphatidate phosphatase PPAPDC1B OS=Homo sapiens E-value=4e-33; Phosphatidate phosphatase PPAPDC1B OS=Mus musculus E-value=3e-32; |
Length | 953 nt |
Species | Medicago sativa |
Belonged EST Libraries | MS_TRI2; |
Sequence | ATAAGTTCATAACATTCATTTCCNCTTCTTCTTCCACCTTCCTCCATCGCATCGAATCGA |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Lipid Metabolism > ko00565 Ether lipid metabolism > K01080 phosphatidate phosphatase; Metabolism > Lipid Metabolism > ko00561 Glycerolipid metabolism > K01080 phosphatidate phosphatase; Metabolism > Lipid Metabolism > ko00564 Glycerophospholipid metabolism > K01080 phosphatidate phosphatase; Metabolism > Lipid Metabolism > ko00600 Sphingolipid metabolism > K01080 phosphatidate phosphatase |
EC | 3.1.3.4 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 838072 |
Trichome-related Gene from Literature | N/A |