Detail of EST/Unigene EX524110 |
Acc. | EX524110 |
Internal Acc. | ALF-R-14_2007-07-24_1/ALF(R)-14_H14_029_1 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Malate dehydrogenase, mitochondrial OS=Citrullus lanatus E-value=2e-79; Malate dehydrogenase 2, mitochondrial OS=Arabidopsis thaliana E-value=6e-78; Malate dehydrogenase, mitochondrial OS=Fragaria ananassa E-value=2e-77; Malate dehydrogenase 1, mitochondrial OS=Arabidopsis thaliana E-value=3e-77; Malate dehydrogenase, mitochondrial OS=Eucalyptus gunnii E-value=4e-77; |
Length | 673 nt |
Species | Medicago sativa |
Belonged EST Libraries | MS_TRI2; |
Sequence | NGTGGGATCGGTCAGCCCCTCTCTCTTCTCATGAAGCTCAACCCTCTCGTTTCAACCCTT |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Carbohydrate Metabolism > ko00020 Citrate cycle (TCA cycle) > K00026 malate dehydrogenase; Metabolism > Carbohydrate Metabolism > ko00630 Glyoxylate and dicarboxylate metabolism > K00026 malate dehydrogenase; Metabolism > Carbohydrate Metabolism > ko00620 Pyruvate metabolism > K00026 malate dehydrogenase; Metabolism > Energy Metabolism > ko00710 Carbon fixation in photosynthetic organisms > K00026 malate dehydrogenase; Metabolism > Energy Metabolism > ko00720 Reductive carboxylate cycle (CO2 fixation) > K00026 malate dehydrogenase |
EC | 1.1.1.37 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 820731 |
Trichome-related Gene from Literature | N/A |