| Detail of EST/Unigene EX527637 |
| Acc. | EX527637 |
| Internal Acc. | MTGland_A031_2007-05-22/MTGlandA031_C12_046_1 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Mitogen-activated protein kinase homolog NTF3 OS=Nicotiana tabacum E-value=3e-97; Mitogen-activated protein kinase homolog 1 OS=Petunia hybrida E-value=2e-96; Mitogen-activated protein kinase 2 OS=Arabidopsis thaliana E-value=6e-92; Mitogen-activated protein kinase 1 OS=Arabidopsis thaliana E-value=6e-92; Mitogen-activated protein kinase 3 OS=Oryza sativa subsp. japonica E-value=1e-91; |
| Length | 799 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_TRI; |
| Sequence | CTCCTAGATCCTCATCAATGTCAAGATCAATTGGAATGATGGCTGGAGGGTCAGAATTAG |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Environmental Information Processing > Signal Transduction > ko04012 ErbB signaling pathway > K04371 extracellular signal-regulated kinase 1/2; Environmental Information Processing > Signal Transduction > ko04010 MAPK signaling pathway > K04371 extracellular signal-regulated kinase 1/2; Environmental Information Processing > Signal Transduction > ko04150 mTOR signaling pathway > K04371 extracellular signal-regulated kinase 1/2; Environmental Information Processing > Signal Transduction > ko04350 TGF-beta signaling pathway > K04371 extracellular signal-regulated kinase 1/2; Environmental Information Processing > Signal Transduction > ko04370 VEGF signaling pathway > K04371 extracellular signal-regulated kinase 1/2 |
| EC | 2.7.11.- 2.7.11.24 |
| Transcription Factor Family | WRKY |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 837559 |
| Trichome-related Gene from Literature | N/A |